View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7359_low_9 (Length: 490)
Name: NF7359_low_9
Description: NF7359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7359_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 390 - 444
Target Start/End: Complemental strand, 11614377 - 11614323
Alignment:
| Q |
390 |
aaagcattgatgtcttaggtatttaccaaagaaccacttccaggagtgaaaaata |
444 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11614377 |
aaagcattgatgtcttaggtatttaccaaagaaccacttccaggagtgaaaaata |
11614323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University