View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7360_low_3 (Length: 339)
Name: NF7360_low_3
Description: NF7360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7360_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 292 - 324
Target Start/End: Complemental strand, 18156426 - 18156394
Alignment:
| Q |
292 |
ttacttcatagttcatagatctccttcaaccag |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
18156426 |
ttacttcatagttcatagatctccttcaaccag |
18156394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University