View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7360_low_4 (Length: 303)
Name: NF7360_low_4
Description: NF7360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7360_low_4 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 10 - 303
Target Start/End: Original strand, 18189475 - 18189767
Alignment:
| Q |
10 |
aagaatatcttatttgtgagacatacaaaaattatggaggacaagccttgcgtcaacgttgccaatcaccctagcattccgaaagagaatcttcagcaca |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18189475 |
aagaaaatcttatttgtgagacatacaaaaattatggaggacaagccttgcgtcaacgttgccaatcaccctagcattccaaaagagaatcttcagcaca |
18189574 |
T |
|
| Q |
110 |
aggaggtggatgatccgcccttgttgcgggttctgtaatgctcagcatcctttacatgccactaccgttgtttttctcttatgtgctttgaatctgacta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18189575 |
aggaggtggatgatccgcccttgttgcgggttctgtaatgctcagcatcctttacatgccactaccgttgtttttctcttatgtgctttgaatctgacta |
18189674 |
T |
|
| Q |
210 |
cctagcaaaccaacaaatttatgctaaattcaagtctttcctaactagctcagtcaattcatcatcatgtgaagagattcctcaaaattaactt |
303 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18189675 |
cctagcaaa-caacaaatttatgctaaattcaagtctttcctaactagctcagtcaattcatcatcatgtgaagagattcctcaaaattaactt |
18189767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 30 - 162
Target Start/End: Original strand, 18194802 - 18194933
Alignment:
| Q |
30 |
acatacaaaaattatggaggacaagccttgcgtcaacgttgccaatcaccctagcattccgaaagagaatcttcagcacaaggaggtggatgatccgc-c |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||| |||| |||||||||||||| | ||||| |||||||||||||||||||| | |
|
|
| T |
18194802 |
acatacaaaaattatggaggacaagccttgcaccgacgttgccaatgcccct-gcattccgaaagagga-cttcatcacaaggaggtggatgatccacag |
18194899 |
T |
|
| Q |
129 |
cttgttgcgggttctgtaatgctcagcatccttt |
162 |
Q |
| |
|
||| ||| ||||| |||||| |||||||||||| |
|
|
| T |
18194900 |
tttgatgcaggttcggtaatgatcagcatccttt |
18194933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University