View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7360_low_6 (Length: 225)
Name: NF7360_low_6
Description: NF7360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7360_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 12 - 208
Target Start/End: Complemental strand, 17892928 - 17892732
Alignment:
| Q |
12 |
gaacctgtgagtatataaaacataacataaagtgtatatataagactttcctttgttatgaacatgcttgaaattttaagacacaacattcatttcctcn |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17892928 |
gaacatgtgagtatataaaacataacataaagtgtatatataagactttcctttgttatgaacatgcttgaaattttaagacacaacattcatttcctca |
17892829 |
T |
 |
| Q |
112 |
nnnnnngtttatgcaatgttgaatattgatgtagttggaaacaagagaaggaagagatgtgggagggtttttaggttcaagaattttggggaacaag |
208 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17892828 |
aaaaaagtttaggcaatgttgaatattgatgtagttggaaacaagagaaggaagagatgtgggagggtttttaggttcaagaattttggggaacaag |
17892732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University