View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7361_low_5 (Length: 253)
Name: NF7361_low_5
Description: NF7361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7361_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 119 - 237
Target Start/End: Original strand, 39943258 - 39943376
Alignment:
| Q |
119 |
gtacataacaggttctactttgatttttctgctacctatgtgggggttgggatgatatgtccatatataatcaatatttcgctgttgattggtggagttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39943258 |
gtacataacaggttctactttgatttttctgctacctatgtgggggttgggatgatatgtccatatataatcaatatttcgctgttgattggtggagttc |
39943357 |
T |
|
| Q |
219 |
tttcttggggtgtcatgtg |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39943358 |
tttcttggggtgtcatgtg |
39943376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 9 - 53
Target Start/End: Original strand, 39943148 - 39943192
Alignment:
| Q |
9 |
tggtggtaggatgatgagttagcaactttttagaaaatattgctg |
53 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39943148 |
tggtgataggatgatgagttagcaactttttagaaaatattgctg |
39943192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 119 - 237
Target Start/End: Complemental strand, 28739690 - 28739572
Alignment:
| Q |
119 |
gtacataacaggttctactttgatttttctgctacctatgtgggggttgggatgatatgtccatatataatcaatatttcgctgttgattggtggagttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28739690 |
gtacataacaggttctactttgatttttctgctacctatgtgggggttgggatgatatgtccatatataatcaatatttcgctgttgattggtggaattc |
28739591 |
T |
|
| Q |
219 |
tttcttggggtgtcatgtg |
237 |
Q |
| |
|
|||| |||| ||||||||| |
|
|
| T |
28739590 |
tttcatgggctgtcatgtg |
28739572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 119 - 237
Target Start/End: Complemental strand, 28749632 - 28749514
Alignment:
| Q |
119 |
gtacataacaggttctactttgatttttctgctacctatgtgggggttgggatgatatgtccatatataatcaatatttcgctgttgattggtggagttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28749632 |
gtacataacaggttctactttgatttttctgctacctatgtgggggttgggatgatatgtccatatataatcaatatttcgctgttgattggtggaattc |
28749533 |
T |
|
| Q |
219 |
tttcttggggtgtcatgtg |
237 |
Q |
| |
|
|||| |||| ||||||||| |
|
|
| T |
28749532 |
tttcatgggctgtcatgtg |
28749514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 119 - 237
Target Start/End: Complemental strand, 28753645 - 28753527
Alignment:
| Q |
119 |
gtacataacaggttctactttgatttttctgctacctatgtgggggttgggatgatatgtccatatataatcaatatttcgctgttgattggtggagttc |
218 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28753645 |
gtacataacaggttttactttgatttttctgctacctatgtgggggttgggatgatatgtccatatataatcaatatttcgctgttgattggtggaattc |
28753546 |
T |
|
| Q |
219 |
tttcttggggtgtcatgtg |
237 |
Q |
| |
|
|||| |||| ||||||||| |
|
|
| T |
28753545 |
tttcatgggctgtcatgtg |
28753527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University