View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7361_low_8 (Length: 221)
Name: NF7361_low_8
Description: NF7361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7361_low_8 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 18270539 - 18270320
Alignment:
| Q |
1 |
tttgatacaggaaaccctatagattttatccaagtaccaaacaattggcttgtgccgatacaacacattcacctaggaaaacaaatgcaccccccacatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270539 |
tttgatacaggaaaccctatagattttatccaagtatcaaacaattggcttgtgccgatacaacacattcacctaggaaaacaaatgcaccccccacatc |
18270440 |
T |
 |
| Q |
101 |
acacagagagggagaaggttcattttttacttcacggggttgaaagaaagattttatcatggccttgcacccacttgcaaagaggtcttcaccagctgag |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270439 |
acacagaga-ggagaaggttcattttttacttcacggggttgaaagaaagattttatcatgcccttgcacccacttgcaaagaggtcttcaccagctgag |
18270341 |
T |
 |
| Q |
201 |
cttttcaacatcttacatcgc |
221 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
18270340 |
cttgtcaacatcttacatcgc |
18270320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University