View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7362_low_3 (Length: 213)
Name: NF7362_low_3
Description: NF7362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7362_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 36117771 - 36117589
Alignment:
| Q |
20 |
agaagcttcaaggagaagttgatgcaagagactctcaaatctcaaccctcagnnnnnnncttgatgagtgcatttcattcaacaaatcacttgnnnnnnn |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36117771 |
agaagcttcaaggagaagttgatgcaagagactctcaaatctcaaccctcagaaaaaaacttgatgagtgcatttcattcaacaaatcacttgaaaaaaa |
36117672 |
T |
 |
| Q |
120 |
gctcaactcaaatgcttctttgtcactctttgttaaccttgaactttcaatgttgaatcatacacactttgtttatattcttc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36117671 |
gctcaactcaaatgcttctttgtcactctttgttaaccttgaactttcaatgttgaatcatacacactttgtttattttcttc |
36117589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University