View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7363_high_13 (Length: 246)
Name: NF7363_high_13
Description: NF7363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7363_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 51 - 230
Target Start/End: Original strand, 44694220 - 44694399
Alignment:
| Q |
51 |
attatcacatcagctatgtcttggcttcatatgcaaaattcctatgggatgctgaagaagatgaagataatgactgccaacataaaactgataagagcca |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694220 |
attatcacatcagctatgtcttggcttcatatgcaaaattcctatgggatgctgaagaagatgaagataatgactgccaacataaaactgataagagcca |
44694319 |
T |
|
| Q |
151 |
tacacattcacctgatctttttctaggagctaatggtcgttctcatgtcactgcagcctctaaaatctaacctctctgct |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694320 |
tacacattcacctgatctttttctaggagctaatggtcgttctcatgtcactgcagcctctaaaatctaacctctctgct |
44694399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 125
Target Start/End: Complemental strand, 2305751 - 2305691
Alignment:
| Q |
65 |
tatgtcttggcttcatatgcaaaattcctatgggatgctgaagaagatgaagataatgact |
125 |
Q |
| |
|
|||||| | ||||||||||| |||||||| |||||||||||| | || |||||||| |||| |
|
|
| T |
2305751 |
tatgtcctagcttcatatgccaaattcctttgggatgctgaaaatgaagaagataaagact |
2305691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University