View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7363_high_15 (Length: 241)
Name: NF7363_high_15
Description: NF7363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7363_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 5 - 223
Target Start/End: Complemental strand, 12338439 - 12338224
Alignment:
| Q |
5 |
gggaattatgtgtctttgaaaggtatgaactcaacgacctaccctttatttctgtgccaccataactatatttccgggtttgaatttcagaccaggatca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12338439 |
gggaattatgtgtctttgaaaggtatgaactcaacgacctaccctttatttctgtgccaccataactatatttccgggtttgaatttcagaccaggatca |
12338340 |
T |
 |
| Q |
105 |
tcttttgtaaacacattcttataatacttcttcattcttattagatatgaacccggttgagaaatattagtgagatacatgtacattcatacggcacaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12338339 |
tcttttgtaaacacattcttataata---cttcattcttataggatatgaacccggttgagaaatattagtgagatacatgtacattcatatggcacaca |
12338243 |
T |
 |
| Q |
205 |
ttgatttttatgatgtaca |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12338242 |
ttgatttttatgatgtaca |
12338224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University