View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7363_low_17 (Length: 249)
Name: NF7363_low_17
Description: NF7363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7363_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 9 - 243
Target Start/End: Original strand, 12338526 - 12338762
Alignment:
| Q |
9 |
ttatagctagattgactattaatgtgagagagagctnnnnnnnntgttattgataggaaggaccgctacacttaatttggttaattatttgttgcttttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12338526 |
ttatagctagattgactattaatgtgagagagagctaaaaaaaatgttattgataggaaggaccactacacttaatttggttaattatttgttgcttttt |
12338625 |
T |
 |
| Q |
109 |
tgtg--tgtatttcagagcacatgcatgcatgatgcatcaatgtttatccttttttagtgatagtaatatcactttcacactcatttttaatagattcac |
206 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12338626 |
tgtgtgtgtatttcagagcacatgcatgcatgatgcatcaatgtttatccttttttagtgatagtaatatcactttcacactcatttttaatagattcac |
12338725 |
T |
 |
| Q |
207 |
ataaagtggtggtgagacacgcatgaatattcttcga |
243 |
Q |
| |
|
|||||||| |||| |||||||||||||| || ||||| |
|
|
| T |
12338726 |
ataaagtgatggtaagacacgcatgaattttattcga |
12338762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University