View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7363_low_21 (Length: 240)
Name: NF7363_low_21
Description: NF7363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7363_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 17529024 - 17528798
Alignment:
| Q |
1 |
tgttggtgctcataatggggtggcattgatgcaaaaaataacagcaactgggtgtgcagtcactgcacttattgctgcctttgttgcagttgacaaaaac |
100 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17529024 |
tgttggtgctcacaatggtgtgccattgatgcaaaaaataacagcaacggggtgtgcagtcactgcacttattgctgcctttgttgcagttgacaaaagc |
17528925 |
T |
|
| Q |
101 |
catgctttagatgcaacagtatcggcattatctgtatttggcgttgctggtgagctgggaatgaaaatggcaaaaggtcctgcatcattgcggatgcact |
200 |
Q |
| |
|
|||||||||||||| ||||||| |||||| |||||||||| |||||||||||| |||||||||| ||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
17528924 |
catgctttagatgcggcagtatcagcattagctgtatttggtgttgctggtgagttgggaatgaagatggcgaaaggtccttcatcgttgcggatgcact |
17528825 |
T |
|
| Q |
201 |
tgatagatgcactctacggtcttgatg |
227 |
Q |
| |
|
|||||||| |||||||||||||||||| |
|
|
| T |
17528824 |
tgatagattcactctacggtcttgatg |
17528798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 17657549 - 17657775
Alignment:
| Q |
1 |
tgttggtgctcataatggggtggcattgatgcaaaaaataacagcaactgggtgtgcagtcactgcacttattgctgcctttgttgcagttgacaaaaac |
100 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17657549 |
tgttggtgctcacaatggtgtgccattgatgcaaaaaataacagcaacggggtgtgcagtcactgcacttattgctgcctttgttgcagttgacaaaagc |
17657648 |
T |
|
| Q |
101 |
catgctttagatgcaacagtatcggcattatctgtatttggcgttgctggtgagctgggaatgaaaatggcaaaaggtcctgcatcattgcggatgcact |
200 |
Q |
| |
|
|||||||||||||| ||||||| |||||| ||||||| || ||||| |||||| |||||||||| ||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
17657649 |
catgctttagatgcggcagtatcagcattagctgtattaggtgttgcaggtgagttgggaatgaagatggcgaaaggtcctacatcgttgcggatgcact |
17657748 |
T |
|
| Q |
201 |
tgatagatgcactctacggtcttgatg |
227 |
Q |
| |
|
|||||||| |||||||||||||||||| |
|
|
| T |
17657749 |
tgatagattcactctacggtcttgatg |
17657775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University