View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7363_low_25 (Length: 222)

Name: NF7363_low_25
Description: NF7363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7363_low_25
NF7363_low_25
[»] chr6 (1 HSPs)
chr6 (1-222)||(23118360-23118581)


Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 23118360 - 23118581
Alignment:
1 ggattcatgttaaaaaccgaaggctggagaggatttgcggccagaggaggcatgttgagaaggatgttaagcgcgcttgcttgccagttcctctgaattt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23118360 ggattcatgttaaaaaccgaaggctggagaggatttgcggccagaggaggcatgttgagaaggatgttaagcgcgcttgcttgccagttcctctgaattt 23118459  T
101 gtaattcaagagtattgtaggccagatggttcatgatggcaatttgattttcacacagcttacggatgtcatcccgagtcttgctcgtgttcttctcaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23118460 gtaattcaagagtattgtaggccagatggttcatgatggcaatttgattttcacacagcttacggatgtcatcccgagtcttgctcgtgttcttctcaat 23118559  T
201 tttagaacgttttggtggtatc 222  Q
    ||||||||||||||||||||||    
23118560 tttagaacgttttggtggtatc 23118581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University