View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7363_low_27 (Length: 212)
Name: NF7363_low_27
Description: NF7363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7363_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 85 - 201
Target Start/End: Original strand, 22313172 - 22313288
Alignment:
| Q |
85 |
agaatcttcttgatggcacagtggaaatttggttgatgcgacgttatgggataattattctctggaattgatgaaatttctggctgaacaagacgcttcg |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
22313172 |
agaatcttcttgatggcacagtggaaatttggttgatgcgacgttatgggataattattctctggaattgatgaaatttctggctgaacgagacgattcg |
22313271 |
T |
|
| Q |
185 |
ggccctgttgtgttgat |
201 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
22313272 |
ggccctgttgtgttgat |
22313288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 85 - 173
Target Start/End: Original strand, 25459645 - 25459733
Alignment:
| Q |
85 |
agaatcttcttgatggcacagtggaaatttggttgatgcgacgttatgggataattattctctggaattgatgaaatttctggctgaac |
173 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||||||||| ||||||| |
|
|
| T |
25459645 |
agaatcttcttgatggtgcagtggaaatttggttgatgcgactttatgggataaatattctctggatttgatgaaatttcttgctgaac |
25459733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 85 - 173
Target Start/End: Complemental strand, 1964162 - 1964074
Alignment:
| Q |
85 |
agaatcttcttgatggcacagtggaaatttggttgatgcgacgttatgggataattattctctggaattgatgaaatttctggctgaac |
173 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| || ||||||||||| ||||||||||| |||||||||||||| ||||||| |
|
|
| T |
1964162 |
agaatcttcttgatggtgcagtggaaatttggttgatgcaactttatgggataaatattctctggatttgatgaaatttcttgctgaac |
1964074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University