View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7364_high_4 (Length: 205)

Name: NF7364_high_4
Description: NF7364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7364_high_4
NF7364_high_4
[»] chr3 (1 HSPs)
chr3 (7-133)||(42575918-42576044)


Alignment Details
Target: chr3 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 7 - 133
Target Start/End: Complemental strand, 42576044 - 42575918
Alignment:
7 agttctgttgctattcggtggggggtgtggggcggttgtccatcttgcccatcctatgggttctacttttctttctttattgcagggtggagttgcagct 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42576044 agttctgttgctattcggtggggggtgtggggcggttgtccatcttgcccatcctatgggttctacttttctttctttattgcagggtggagttgcagct 42575945  T
107 tttcgttggagtgtctctagttccttg 133  Q
    |||||||||||||||||||||||||||    
42575944 tttcgttggagtgtctctagttccttg 42575918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University