View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7364_low_5 (Length: 205)
Name: NF7364_low_5
Description: NF7364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7364_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 7 - 133
Target Start/End: Complemental strand, 42576044 - 42575918
Alignment:
| Q |
7 |
agttctgttgctattcggtggggggtgtggggcggttgtccatcttgcccatcctatgggttctacttttctttctttattgcagggtggagttgcagct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42576044 |
agttctgttgctattcggtggggggtgtggggcggttgtccatcttgcccatcctatgggttctacttttctttctttattgcagggtggagttgcagct |
42575945 |
T |
 |
| Q |
107 |
tttcgttggagtgtctctagttccttg |
133 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42575944 |
tttcgttggagtgtctctagttccttg |
42575918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University