View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7365_high_4 (Length: 250)
Name: NF7365_high_4
Description: NF7365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7365_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 13 - 116
Target Start/End: Original strand, 47849342 - 47849445
Alignment:
| Q |
13 |
attctacgtggcttctttagttgatcaatataggtcctacttggattgaccagggatccagggtggatgtaccttgacctactgaaggtcaaattgtgat |
112 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47849342 |
attctacgtggcttctttagttgctcaatataggtcctacttggactgaccagggatccagggtggatgtaccttgacctaatgaaggtcaaattgtgat |
47849441 |
T |
|
| Q |
113 |
ttat |
116 |
Q |
| |
|
|||| |
|
|
| T |
47849442 |
ttat |
47849445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 197 - 246
Target Start/End: Original strand, 47849602 - 47849651
Alignment:
| Q |
197 |
gacatctatttttagatacataataattacttgatgcctcaaacttagca |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47849602 |
gacatctatttttagatacataataattacttgatgcctcaaacttagca |
47849651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University