View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7365_high_6 (Length: 243)
Name: NF7365_high_6
Description: NF7365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7365_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 9926480 - 9926702
Alignment:
| Q |
1 |
cactatttcttagcgaaaattgtgaattgcaggcttttctaattgccctaaggaaaccttgcaataaacaccccggataaggaattcagaaacaacggcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
9926480 |
cactatttcttagcgaaaattgtgaattgcaggcttttctaatttccctaaggaaaccttgcaataaacacctcagataaggaattcagaaacaacggcc |
9926579 |
T |
|
| Q |
101 |
aaacatccctataaaaagtgtactatggtctgcacgagttttgtttcaaaatagaccaatttctaacaagcattgatatacggttatcagacgttggtct |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9926580 |
aaacattcctataaaaagtgtactatggtctgcacgagttttgtttcaaaatagaccaatttctaacaagcattgatatacggttatcagacgttggtct |
9926679 |
T |
|
| Q |
201 |
aactcacgcccaccattctatat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9926680 |
aactcacgcccaccattctatat |
9926702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University