View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7365_high_7 (Length: 239)
Name: NF7365_high_7
Description: NF7365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7365_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 47850776 - 47850999
Alignment:
| Q |
1 |
ttctctttttgttattttaatactctggatcattacatgcctatcaacaagaattgagtttccatccaatcacataa-----tgcatgcagtcacacaat |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47850776 |
ttctctttttgttattttaatactctggatcattacatgcctatcaacaagaattgagtttccatccaatcacataacataatgcatgcagtcacacaat |
47850875 |
T |
|
| Q |
96 |
tagaaatatgtacaccaa-cccaaacacaagaattaaattacagcctcttggtgtcactctaatatatgtacacaatatgtgtagagaccacaaagttat |
194 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47850876 |
tagaaatatgtacaccaaacccaaacacaagaattaaaatacagccccttggtgtcactctaatatatgtacacaatatgtgtagagaccacaaagttat |
47850975 |
T |
|
| Q |
195 |
tttgaccatttttcacatagggta |
218 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47850976 |
tttgaccatttttcacatagggta |
47850999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University