View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7369_high_11 (Length: 241)
Name: NF7369_high_11
Description: NF7369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7369_high_11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 241
Target Start/End: Complemental strand, 41281108 - 41280883
Alignment:
| Q |
16 |
atcctatgctctttaatttagtaggacccagtgaaattaagtaagtgtattaaaatgtatctaaatatttttgtcgtgttttgaaaaagagacaaccgcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41281108 |
atcctatgctctttaatttagtaggacccagtgaaattaaataagtgtattaaaatgtatctaaatatttttgtcgtgttttggaaaagagacaaccgcg |
41281009 |
T |
 |
| Q |
116 |
tgaggcagtgttaaaacgacaaccgttttgccgacgaaatcctttttgcctttattattctttttcaaacaccgcatttatacggacttttgaccaaact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41281008 |
tgaggcagtgttaaaacgacaaccgttttgccgacgaaatcctttttgcctttattattctttttcaaacaccgcatttatacggacttttgaccaaact |
41280909 |
T |
 |
| Q |
216 |
aaaatcaaatctccattaataaattt |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41280908 |
aaaatcaaatctccattaataaattt |
41280883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University