View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7371_low_3 (Length: 303)
Name: NF7371_low_3
Description: NF7371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7371_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 18 - 167
Target Start/End: Original strand, 2939269 - 2939418
Alignment:
| Q |
18 |
aaaggcgatatgaaaacttcaagagatcgaaatagaactccttcaatggctatagcctatatataattgcatgcaacgtttgaatatacttaggatcaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939269 |
aaaggcgatatgaaaacttcaagagatcgaaatagaactccttcaatggctatagcctatatataattgcatgcaacgtttgaatatacttaggatcaac |
2939368 |
T |
 |
| Q |
118 |
aaaacctagacaaatttgagtatgctattctaatgttacatatacgattc |
167 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2939369 |
aaaacctagacaaatttgagaatgctattctaatgttacatatacgattc |
2939418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 233 - 301
Target Start/End: Original strand, 2939484 - 2939552
Alignment:
| Q |
233 |
ggtactaaccctaatgatcgtgacaaaaccttgagtgttgatcgatgaatggatccaatatcggcggtt |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2939484 |
ggtactaaccctaatgatcgtgacaaaaccttgagtgttgatcgatgaatggatccaatatcggcggtt |
2939552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University