View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7372_high_13 (Length: 254)
Name: NF7372_high_13
Description: NF7372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7372_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 56240821 - 56240581
Alignment:
| Q |
1 |
ttagtcctcattgcaggatcaatcaatctgccaacaaatcaatcaaaactcaaaggatgatttctcttaggtccactagttctgccactaaggttctcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56240821 |
ttagtcctcattgcaggatcaatcaatctgccaacaaatcaatcaaaactcaaaggatgatgtctcttaggtccactagttctgccactaaggttctcct |
56240722 |
T |
 |
| Q |
101 |
aaattcttactatgcattcattactcctctttcttacattttcatattccttatcnnnnnnnnnnnnnaatgtttcacagctcaacacagtcggtcttca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
56240721 |
aaattcttactatgcattcattactcctctttcttacattttcatattccttatcttttttcttgtttaatgtttcacagctcaacacagtcggtcttca |
56240622 |
T |
 |
| Q |
201 |
ggagcacatacctgtgcaggattcagaacttgttctctctg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
56240621 |
ggagcacatacctgtgcaggattcagaagttgttctctctg |
56240581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 23947141 - 23947055
Alignment:
| Q |
1 |
ttagtcctcattgcaggatcaatcaatctgccaacaaatcaatcaaaactcaaaggatgatttctcttaggtccactagttctgcca |
87 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
23947141 |
ttagtcctgattgcaggatcaataaatctgccaacaaatcaatcaaaactcaaaggatgatgtctcttaggtccacaagttccgcca |
23947055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 182 - 241
Target Start/End: Complemental strand, 23947048 - 23946989
Alignment:
| Q |
182 |
tcaacacagtcggtcttcaggagcacatacctgtgcaggattcagaacttgttctctctg |
241 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23947048 |
tcaacacactgggtcttcaggagcacatacctgtgcaggattcagaagttgttctctctg |
23946989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 16105803 - 16105889
Alignment:
| Q |
1 |
ttagtcctcattgcaggatcaatcaatctgccaacaaatcaatcaaaactcaaaggatgatttctcttaggtccactagttctgcca |
87 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
16105803 |
ttagtcctgattgcaggatcaatcaatctgccaacaaatcaatcaaaactcaaaggatgatgtctcttaggtccacaagttccgcca |
16105889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 182 - 241
Target Start/End: Original strand, 16105896 - 16105955
Alignment:
| Q |
182 |
tcaacacagtcggtcttcaggagcacatacctgtgcaggattcagaacttgttctctctg |
241 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16105896 |
tcaacacactgggtcttcaggagcacatacctgtgcaggattcagaagttgttctctctg |
16105955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 241
Target Start/End: Original strand, 16624287 - 16624359
Alignment:
| Q |
169 |
aatgtttcacagctcaacacagtcggtcttcaggagcacatacctgtgcaggattcagaacttgttctctctg |
241 |
Q |
| |
|
||||||| ||| ||||||||| || |||||||||||||||||| |||| ||| ||||| ||||||| |||| |
|
|
| T |
16624287 |
aatgtttgtcaggtcaacacaggaggacttcaggagcacatacctttgcatgatccagaagttgttctttctg |
16624359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University