View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7372_low_7 (Length: 303)
Name: NF7372_low_7
Description: NF7372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7372_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 42299086 - 42298842
Alignment:
| Q |
1 |
tatcattgctttaaaatat--gaagggaaactcaagcaactgtcggtgatcttttttagaggaccacttggtgcaatttgtaaagtgatcttttaaattt |
98 |
Q |
| |
|
|||||||||| |||||||| ||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42299086 |
tatcattgctctaaaatatatgaaggtaaagtgaagcaactgtcggtgatcttttttagaggaccacttggtgcaatttgtaaagtggtcttttaaattt |
42298987 |
T |
 |
| Q |
99 |
taattgttctactactatgtctacagctgtctctctctacatgtaaatctcatttaaaaatacgtcgattattttttacnnnnnnnngtacacatcaatt |
198 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42298986 |
taattgttctactactatgtctaccgctgtctctctctacatgtaaatctcatttaaaaatacgtcgattattttttacaaaaaaaagtacacatcaatt |
42298887 |
T |
 |
| Q |
199 |
taaccaacattgtttcactacaaaaataatcaaagaatgatgtta |
243 |
Q |
| |
|
|||||||||||||||| ||||||||||||| | |||||||||||| |
|
|
| T |
42298886 |
taaccaacattgtttccctacaaaaataattagagaatgatgtta |
42298842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University