View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7372_low_8 (Length: 300)
Name: NF7372_low_8
Description: NF7372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7372_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 174 - 280
Target Start/End: Complemental strand, 35974913 - 35974807
Alignment:
| Q |
174 |
tggggcatgtagatgataatctaattgatgaatatggggcaatgcaaagtttggattttgtacaaattggttcccctaaagagagtaataatcctcatgt |
273 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35974913 |
tggggcatatagatgataatctaattgatgaatatggggcaatgcaaagtttggattttgtacaaattggttcccctaaagagagtaataatcctcatgt |
35974814 |
T |
|
| Q |
274 |
ggggact |
280 |
Q |
| |
|
||||||| |
|
|
| T |
35974813 |
ggggact |
35974807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 74 - 166
Target Start/End: Complemental strand, 35975133 - 35975041
Alignment:
| Q |
74 |
tgatgttgtgcaggttgtagagggtgtgtgtaatgaccagatggatttttcgtggatggataactttgacattacagatgaatacttgaagag |
166 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35975133 |
tgatgttgtgtaggttgtagagggtgtgtgtaatgaccagatggatttttcgtggatggataactttgacattacagatgaatacttgaagag |
35975041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 74 - 143
Target Start/End: Complemental strand, 35978072 - 35978003
Alignment:
| Q |
74 |
tgatgttgtgcaggttgtagagggtgtgtgtaatgaccagatggatttttcgtggatggataactttgac |
143 |
Q |
| |
|
||||| ||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35978072 |
tgatgctgtgctggttggagagggtgtgtgtaatgaccagatggatttttcatggatggataactttgac |
35978003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 43
Target Start/End: Complemental strand, 35978139 - 35978103
Alignment:
| Q |
7 |
ttggtggtggtgaaagccaagatgcaaattcagaagg |
43 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35978139 |
ttggtggtggtgaaatccaagatgcaaattcagaagg |
35978103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 178 - 249
Target Start/End: Complemental strand, 35975017 - 35974946
Alignment:
| Q |
178 |
gcatgtagatgataatctaattgatgaatatggggcaatgcaaagtttggattttgtacaaattggttcccc |
249 |
Q |
| |
|
|||| |||||||||| | |||||||||||||||| ||||||||||||||| | ||||||||||||||| |
|
|
| T |
35975017 |
gcatatagatgataaaccaattgatgaatatgggctgcggcaaagtttggatttgggacaaattggttcccc |
35974946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University