View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7372_low_9 (Length: 299)
Name: NF7372_low_9
Description: NF7372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7372_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 27935691 - 27935432
Alignment:
| Q |
1 |
actagaaaatccacggggtagggatggttaagaaacgataaaatggaagaaacaaatagaaagaactgaaggggagacataacaagagctatgagggtta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
27935691 |
actagaaaatccacggggtagggatggttaagaaacgataaaatggaagaaacaaatagaaagaactaaagggaagacataacaagagctatgagggtta |
27935592 |
T |
 |
| Q |
101 |
gcgaggtttccccctgttaatatgacaagatnnnnnnnttagttctctcatttacaacacctctttctctgtttatatgtttttctgttgttatgactta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27935591 |
gcgaggtttccccctgttaatatgacaagataaaaaaattagttctctcatttacgacacctctttctctgtttatatgtttttctgttgttatgactta |
27935492 |
T |
 |
| Q |
201 |
tgagttgaaattatgaacggttgaactatggagggtttgtggtgtttggttgaggattat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||| |
|
|
| T |
27935491 |
tgagttgaaattatgaacggttgaactatggagggtttgtgttggttggttgatgattat |
27935432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University