View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7373_high_2 (Length: 250)
Name: NF7373_high_2
Description: NF7373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7373_high_2 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 67 - 250
Target Start/End: Complemental strand, 44251119 - 44250935
Alignment:
| Q |
67 |
caagtaggaacgattagagattttctcaagactatcacagaaagtgacaactcaactaacttcatataatgtatgacgtgaacaattaaaa-tatctagc |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44251119 |
caagtaggaacgattagagattttctcaagactatcacagaaagtgacaactcaactaacttcatataatgtatgacgtgaacaattaaaaatatctagc |
44251020 |
T |
 |
| Q |
166 |
cttaacaatgatatatgtataagtaaataaatactttgataattggtacataagcataaaataatcaattgcatgtttcaaattt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44251019 |
cttaacaatgatatatgtataagtaaataaatactttgataattggtacataagcataaaataatcaattgcatgtttcaaattt |
44250935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University