View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7374_low_12 (Length: 304)
Name: NF7374_low_12
Description: NF7374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7374_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 5e-56; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 184 - 298
Target Start/End: Complemental strand, 6668238 - 6668124
Alignment:
| Q |
184 |
ccatcttttctaaaaatgaaaatcattttttaataaatttcatcaagcaaattgaagaaaaaatctcaatcaccaaagattagtagcttccaataccgac |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6668238 |
ccatcttttctaaaaatgaaaatcattttttaataaatttcatcaagcaaattgaagaaaaaatctcaatcaccaaagattagtagcttccaataccgac |
6668139 |
T |
 |
| Q |
284 |
accgctctctgctac |
298 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
6668138 |
accgctctccgctac |
6668124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 54
Target Start/End: Complemental strand, 6668379 - 6668344
Alignment:
| Q |
19 |
agcaattcacatatcacaaacaacatgcaaagctcc |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6668379 |
agcaattcacatatcacaaacaacatgcaaagctcc |
6668344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 246
Target Start/End: Original strand, 12529663 - 12529723
Alignment:
| Q |
188 |
cttttctaaaaatgaaaatca--ttttttaataaatttcatcaagcaaattgaagaaaaaa |
246 |
Q |
| |
|
|||||||||||||||| | || ||||||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
12529663 |
cttttctaaaaatgaacaacagtttttttattaaatttcatcaatcaaattgaacaaaaaa |
12529723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 120 - 148
Target Start/End: Complemental strand, 6668277 - 6668249
Alignment:
| Q |
120 |
ctgaagctacaacattaaataaagtgaaa |
148 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6668277 |
ctgaagctacaacattaaataaagtgaaa |
6668249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University