View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7374_low_13 (Length: 296)

Name: NF7374_low_13
Description: NF7374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7374_low_13
NF7374_low_13
[»] chr4 (2 HSPs)
chr4 (7-92)||(13226749-13226834)
chr4 (244-279)||(13226954-13226989)


Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 7 - 92
Target Start/End: Original strand, 13226749 - 13226834
Alignment:
7 tttggtgttgctaagttgattcaaacggacgagtctatgtctgttattgctggttcctatggttacattgctcccggtaagtatca 92  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||    
13226749 tttggtgttgctaagttgattcaaacggacgagtctatgtctgttattgctggttcctatggttacattgctccgggtaaggatca 13226834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 244 - 279
Target Start/End: Original strand, 13226954 - 13226989
Alignment:
244 cttcattatgtgcattatgatctatgacattatctt 279  Q
    ||||||||||||||||||||||||||||||||||||    
13226954 cttcattatgtgcattatgatctatgacattatctt 13226989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University