View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7374_low_13 (Length: 296)
Name: NF7374_low_13
Description: NF7374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7374_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 7 - 92
Target Start/End: Original strand, 13226749 - 13226834
Alignment:
| Q |
7 |
tttggtgttgctaagttgattcaaacggacgagtctatgtctgttattgctggttcctatggttacattgctcccggtaagtatca |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
13226749 |
tttggtgttgctaagttgattcaaacggacgagtctatgtctgttattgctggttcctatggttacattgctccgggtaaggatca |
13226834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 244 - 279
Target Start/End: Original strand, 13226954 - 13226989
Alignment:
| Q |
244 |
cttcattatgtgcattatgatctatgacattatctt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
13226954 |
cttcattatgtgcattatgatctatgacattatctt |
13226989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University