View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7375_high_4 (Length: 407)
Name: NF7375_high_4
Description: NF7375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7375_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 4 - 393
Target Start/End: Complemental strand, 26484009 - 26483626
Alignment:
| Q |
4 |
atgaatgtaatcaggcttatgattttgaatctctgaaccttttgaattttccttggaaccaacatcgtcacaattttctctatttttcaactttgtattc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26484009 |
atgaatgtaatcaggcttatgattttgaatctctgaaccttttgaattttccttggaaccaacatcatcacaattttctctatttttcaactttgtattc |
26483910 |
T |
 |
| Q |
104 |
ttatttccctttgtttgctccgtgattttggattcaccttcttcaacactcactttgatcctcttgtctttggacttcacatccaccttgtgatcagctt |
203 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26483909 |
ttatttccctttatttgctccgtgattttggattcaccttcttcaacactcactttgatcctcttgtctttggacttcatatccaccttgtgatcagctt |
26483810 |
T |
 |
| Q |
204 |
tccttttcttgacagtttcttcaacgttttcgaaacccgggtccccgggtttcatagagttagctacaacctcaccaagagcagaatcacaaccaaccat |
303 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26483809 |
tccttttcttgacagtttcttcgacgttttcgaaacccaggtccccgggtttcatagagttagctacaacctcaccaagagcagaatcacaaccaaccat |
26483710 |
T |
 |
| Q |
304 |
aaaaaattgttgatcttgttcatgttcatgttcatgttggaacttcttccttgctctttgtctttccaacactgtcatgtcggaaatgat |
393 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26483709 |
aaaaaattgttgatcttgttcatgttca------tgttggaacttcttccttgctctttgtctttccaacactgtcatgtcggaaatgat |
26483626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University