View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7376_low_12 (Length: 271)
Name: NF7376_low_12
Description: NF7376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7376_low_12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 4 - 271
Target Start/End: Complemental strand, 3482690 - 3482430
Alignment:
| Q |
4 |
agtttggtggtaaagatcacaagtaaatagagtcgaaaaccccatccaaaagtcatcatggnnnnnnnnttcattgaacnnnnnnnaaggcgtccaaagt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
3482690 |
agtttggtggtaaagatcacaagtaaatagagtcgaaaaccccatccaaaagtcatcatggaaaaaaatttcattgaactttttttaaggcgtccaaagt |
3482591 |
T |
|
| Q |
104 |
aaacatataatttgtgctgtacagttttatttaaagattttgctaatgagttctacaatgaaaaatgtcttagaaatataaaatgttattattgtcaaag |
203 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3482590 |
aaacata--atttgtgctgtacagttttatttaaagattttgctaatgagttctacaatgaaaaatgt-----aaatataaaatgttattattgtcaaag |
3482498 |
T |
|
| Q |
204 |
tacacnnnnnnnnatgcaaacttacttcttttagttctttaaacaatatcacaaaggcactcatttac |
271 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3482497 |
tacacattcttttatgcaaacttacttcttttaattctttaaacaatatcacaaaggcactcatttac |
3482430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University