View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7376_low_3 (Length: 530)

Name: NF7376_low_3
Description: NF7376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7376_low_3
NF7376_low_3
[»] chr8 (3 HSPs)
chr8 (1-331)||(8105171-8105502)
chr8 (398-502)||(8105007-8105115)
chr8 (351-406)||(8105126-8105181)
[»] chr2 (3 HSPs)
chr2 (226-283)||(21481535-21481592)
chr2 (315-377)||(21481476-21481538)
chr2 (397-487)||(21481339-21481433)
[»] chr4 (2 HSPs)
chr4 (221-286)||(51028405-51028470)
chr4 (479-511)||(53896743-53896775)
[»] chr3 (3 HSPs)
chr3 (335-405)||(36990259-36990333)
chr3 (335-405)||(37015699-37015773)
chr3 (335-406)||(35741505-35741580)


Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 8105502 - 8105171
Alignment:
1 ttttgatttttattactcacagacacacaacaagattgagaaagaggttttgattttggtttcattgatttattgggtttccatattaaatgaagaacat 100  Q
    |||||||||| |||||||| ||||||||||||||||||||||||||||||||||||  |||||||||||||  ||||||||||||||||||||||||||     
8105502 ttttgattttgattactcagagacacacaacaagattgagaaagaggttttgatttgagtttcattgattttctgggtttccatattaaatgaagaacac 8105403  T
101 aaagaggatgagagaattaagatgaacacatggattggggagtaaggattgggaaaaggaaaacgaaattagggatgctggactgtaataattgaaactg 200  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||     
8105402 gaagaggatgagagaattaagatgaacacatggattggggagtaaggattgggaaaaggaaaacgaaattagggattctggactgtaataattgaaactt 8105303  T
201 gaggggaagaaaattggatccgaatttaaaagattatattctgaattttggaggggaagaaaattagggtttaaaatcaaagttt-gggcttctgattta 299  Q
    |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||    
8105302 gaggggaagaaaattgaatccgaatttaaaaggttatattctgaattttggaggggaagaaaattagggtttaaaattaaagtttggggcttctgattta 8105203  T
300 caacataaattgtctaagtaagatgatggtgg 331  Q
    ||||||||||||||||||||||||| ||||||    
8105202 caacataaattgtctaagtaagatggtggtgg 8105171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 398 - 502
Target Start/End: Complemental strand, 8105115 - 8105007
Alignment:
398 ggagagatggggaagaggaacaaagagatgatagtgtggag----gatcgagatggagaacgagggtggtggatggtggtgtgctgcgatgatgaacaac 493  Q
    ||||||||||||||||||||||||||||||||||||  | |    ||  ||||||||||||||| ||||||||||||||||||||||||||||||||| |    
8105115 ggagagatggggaagaggaacaaagagatgatagtggagggtgcagaaggagatggagaacgagagtggtggatggtggtgtgctgcgatgatgaacagc 8105016  T
494 gtgatggac 502  Q
    |||||||||    
8105015 gtgatggac 8105007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 351 - 406
Target Start/End: Complemental strand, 8105181 - 8105126
Alignment:
351 gatggtggcggtgactgaggaggaaggtgtggtgcttgattgacgagggagagatg 406  Q
    |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||    
8105181 gatggtggtggtgactgaggaggaaggtgtggtgattgattgacgagggagagatg 8105126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 5e-17; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 226 - 283
Target Start/End: Complemental strand, 21481592 - 21481535
Alignment:
226 ttaaaagattatattctgaattttggaggggaagaaaattagggtttaaaatcaaagt 283  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||| ||| |||||    
21481592 ttaaaaggttatattctgaattttggaggggaagaaaattagggtttagaattaaagt 21481535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 315 - 377
Target Start/End: Complemental strand, 21481538 - 21481476
Alignment:
315 aagtaagatgatggtggatgtggtggtggcgacgaggatggtggcggtgactgaggaggaagg 377  Q
    |||| ||||| | |||| |||||||||||||||||||||||||| ||||||||||||||||||    
21481538 aagtgagatggttgtgggtgtggtggtggcgacgaggatggtggtggtgactgaggaggaagg 21481476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 397 - 487
Target Start/End: Complemental strand, 21481433 - 21481339
Alignment:
397 gggagagatggggaagaggaacaaagagatgatagtgtggag----gatcgagatggagaacgagggtggtggatggtggtgtgctgcgatgatg 487  Q
    |||||||||||||||||||||||||||||||| ||||  | |    ||  |||| | ||||||| ||||||||||||||||| ||||| ||||||    
21481433 gggagagatggggaagaggaacaaagagatgacagtggagggtgtagaaggagaggaagaacgaaggtggtggatggtggtgcgctgcaatgatg 21481339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 221 - 286
Target Start/End: Complemental strand, 51028470 - 51028405
Alignment:
221 cgaatttaaaagattatattctgaattttggaggggaagaaaattagggtttaaaatcaaagtttg 286  Q
    |||||||||| | ||| ||| ||||||||| |||||||||||||||||||||| ||||||||||||    
51028470 cgaatttaaatggttaaattatgaattttgaaggggaagaaaattagggtttagaatcaaagtttg 51028405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 479 - 511
Target Start/End: Complemental strand, 53896775 - 53896743
Alignment:
479 gcgatgatgaacaacgtgatggacagtgagatg 511  Q
    |||||||||||||||||||||||| ||||||||    
53896775 gcgatgatgaacaacgtgatggacggtgagatg 53896743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.000000000003; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 335 - 405
Target Start/End: Complemental strand, 36990333 - 36990259
Alignment:
335 tggtggtggcgacgaggatggtggcggtgactgaggaggaagg----tgtggtgcttgattgacgagggagagat 405  Q
    |||||||||||||||||||||||| ||||| ||||||||||||     |||||| |||||||| |||||||||||    
36990333 tggtggtggcgacgaggatggtggtggtgattgaggaggaagggtgtggtggtgattgattgatgagggagagat 36990259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 335 - 405
Target Start/End: Complemental strand, 37015773 - 37015699
Alignment:
335 tggtggtggcgacgaggatggtggcggtgactgaggaggaagg----tgtggtgcttgattgacgagggagagat 405  Q
    |||||||||||||||||||||||| ||||| ||||||||||||     |||||| |||||||| |||||||||||    
37015773 tggtggtggcgacgaggatggtggtggtgattgaggaggaagggtgtggtggtgattgattgatgagggagagat 37015699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 335 - 406
Target Start/End: Original strand, 35741505 - 35741580
Alignment:
335 tggtggtggcgacgaggatggtggcggtgactgaggaggaagg----tgtggtgcttgattgacgagggagagatg 406  Q
    ||||||||| |||||||||||||| ||||| ||||||||||||     |||||| |||||||| ||||||||||||    
35741505 tggtggtggtgacgaggatggtggtggtgattgaggaggaagggtgtggtggtgattgattgatgagggagagatg 35741580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University