View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7376_low_3 (Length: 530)
Name: NF7376_low_3
Description: NF7376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7376_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 8105502 - 8105171
Alignment:
| Q |
1 |
ttttgatttttattactcacagacacacaacaagattgagaaagaggttttgattttggtttcattgatttattgggtttccatattaaatgaagaacat |
100 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8105502 |
ttttgattttgattactcagagacacacaacaagattgagaaagaggttttgatttgagtttcattgattttctgggtttccatattaaatgaagaacac |
8105403 |
T |
 |
| Q |
101 |
aaagaggatgagagaattaagatgaacacatggattggggagtaaggattgggaaaaggaaaacgaaattagggatgctggactgtaataattgaaactg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8105402 |
gaagaggatgagagaattaagatgaacacatggattggggagtaaggattgggaaaaggaaaacgaaattagggattctggactgtaataattgaaactt |
8105303 |
T |
 |
| Q |
201 |
gaggggaagaaaattggatccgaatttaaaagattatattctgaattttggaggggaagaaaattagggtttaaaatcaaagttt-gggcttctgattta |
299 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
8105302 |
gaggggaagaaaattgaatccgaatttaaaaggttatattctgaattttggaggggaagaaaattagggtttaaaattaaagtttggggcttctgattta |
8105203 |
T |
 |
| Q |
300 |
caacataaattgtctaagtaagatgatggtgg |
331 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |
|
|
| T |
8105202 |
caacataaattgtctaagtaagatggtggtgg |
8105171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 398 - 502
Target Start/End: Complemental strand, 8105115 - 8105007
Alignment:
| Q |
398 |
ggagagatggggaagaggaacaaagagatgatagtgtggag----gatcgagatggagaacgagggtggtggatggtggtgtgctgcgatgatgaacaac |
493 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | | || ||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
8105115 |
ggagagatggggaagaggaacaaagagatgatagtggagggtgcagaaggagatggagaacgagagtggtggatggtggtgtgctgcgatgatgaacagc |
8105016 |
T |
 |
| Q |
494 |
gtgatggac |
502 |
Q |
| |
|
||||||||| |
|
|
| T |
8105015 |
gtgatggac |
8105007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 351 - 406
Target Start/End: Complemental strand, 8105181 - 8105126
Alignment:
| Q |
351 |
gatggtggcggtgactgaggaggaaggtgtggtgcttgattgacgagggagagatg |
406 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8105181 |
gatggtggtggtgactgaggaggaaggtgtggtgattgattgacgagggagagatg |
8105126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 5e-17; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 226 - 283
Target Start/End: Complemental strand, 21481592 - 21481535
Alignment:
| Q |
226 |
ttaaaagattatattctgaattttggaggggaagaaaattagggtttaaaatcaaagt |
283 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
21481592 |
ttaaaaggttatattctgaattttggaggggaagaaaattagggtttagaattaaagt |
21481535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 315 - 377
Target Start/End: Complemental strand, 21481538 - 21481476
Alignment:
| Q |
315 |
aagtaagatgatggtggatgtggtggtggcgacgaggatggtggcggtgactgaggaggaagg |
377 |
Q |
| |
|
|||| ||||| | |||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21481538 |
aagtgagatggttgtgggtgtggtggtggcgacgaggatggtggtggtgactgaggaggaagg |
21481476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 397 - 487
Target Start/End: Complemental strand, 21481433 - 21481339
Alignment:
| Q |
397 |
gggagagatggggaagaggaacaaagagatgatagtgtggag----gatcgagatggagaacgagggtggtggatggtggtgtgctgcgatgatg |
487 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| | | || |||| | ||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
21481433 |
gggagagatggggaagaggaacaaagagatgacagtggagggtgtagaaggagaggaagaacgaaggtggtggatggtggtgcgctgcaatgatg |
21481339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 221 - 286
Target Start/End: Complemental strand, 51028470 - 51028405
Alignment:
| Q |
221 |
cgaatttaaaagattatattctgaattttggaggggaagaaaattagggtttaaaatcaaagtttg |
286 |
Q |
| |
|
|||||||||| | ||| ||| ||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
51028470 |
cgaatttaaatggttaaattatgaattttgaaggggaagaaaattagggtttagaatcaaagtttg |
51028405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 479 - 511
Target Start/End: Complemental strand, 53896775 - 53896743
Alignment:
| Q |
479 |
gcgatgatgaacaacgtgatggacagtgagatg |
511 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
53896775 |
gcgatgatgaacaacgtgatggacggtgagatg |
53896743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000003; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 335 - 405
Target Start/End: Complemental strand, 36990333 - 36990259
Alignment:
| Q |
335 |
tggtggtggcgacgaggatggtggcggtgactgaggaggaagg----tgtggtgcttgattgacgagggagagat |
405 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
36990333 |
tggtggtggcgacgaggatggtggtggtgattgaggaggaagggtgtggtggtgattgattgatgagggagagat |
36990259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 335 - 405
Target Start/End: Complemental strand, 37015773 - 37015699
Alignment:
| Q |
335 |
tggtggtggcgacgaggatggtggcggtgactgaggaggaagg----tgtggtgcttgattgacgagggagagat |
405 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
37015773 |
tggtggtggcgacgaggatggtggtggtgattgaggaggaagggtgtggtggtgattgattgatgagggagagat |
37015699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 335 - 406
Target Start/End: Original strand, 35741505 - 35741580
Alignment:
| Q |
335 |
tggtggtggcgacgaggatggtggcggtgactgaggaggaagg----tgtggtgcttgattgacgagggagagatg |
406 |
Q |
| |
|
||||||||| |||||||||||||| ||||| |||||||||||| |||||| |||||||| |||||||||||| |
|
|
| T |
35741505 |
tggtggtggtgacgaggatggtggtggtgattgaggaggaagggtgtggtggtgattgattgatgagggagagatg |
35741580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University