View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7377_high_11 (Length: 240)
Name: NF7377_high_11
Description: NF7377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7377_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 10340694 - 10340478
Alignment:
| Q |
18 |
ttacacaggcattaggtgcagtggctggtgctaaggcaattaaggaagtaataccgccaaaatatagtcacatgattggaggacctgctttgaaggttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10340694 |
ttacacaggcattaggtgcagtggctggtgctaaggcaattaaggaagtaataccgccaaaatatagtcacatgattggaggacctgctttgaaggttga |
10340595 |
T |
 |
| Q |
118 |
tttgcatactggagctatagcagaaggagtgttgacattttcaatcacttttgctgttctcttcatcttgctcagaggtcctcgtagtgagttcatgaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10340594 |
tttgcatactggagctatagcagaaggagtgttgacattttcaatcacttttgctgttctcttcatcttgctcagaggtcctcgtagtgagttcatgaag |
10340495 |
T |
 |
| Q |
218 |
actttgttgatgtccat |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
10340494 |
actttgttgatgtccat |
10340478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University