View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7377_high_13 (Length: 230)

Name: NF7377_high_13
Description: NF7377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7377_high_13
NF7377_high_13
[»] chr7 (1 HSPs)
chr7 (14-211)||(26333730-26333927)


Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 211
Target Start/End: Complemental strand, 26333927 - 26333730
Alignment:
14 aatatcataactgggaaacttctgaacttaatactaataataatcataatcataatcatattaaccaagttggtccaattaatggtgcacctaaattcaa 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
26333927 aatatcataactgggaaacttctgaacttaatactaataataatcataatcataatcataataaccaagttggtccaattaatggtgcacctaaattcaa 26333828  T
114 atctgttcaaccaccttcattacctctttcatcttcaccatcttttcacttaccattttcatctacttttagtcctactgatttcttgatctcacctt 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
26333827 atctgttcaaccaccttcattacctctttcatcttcaccatcttttcacttaccattttaatctacttttagtcctactgatttcttgatctcacctt 26333730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University