View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7377_high_7 (Length: 304)
Name: NF7377_high_7
Description: NF7377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7377_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 19 - 294
Target Start/End: Complemental strand, 12922119 - 12921844
Alignment:
| Q |
19 |
aacagaatgttcattcatgcatagtctgaagaaagttccatgctttagcttcctttatgtgcttatgtgcatcttaagaggagaggatatgtgaagtatc |
118 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12922119 |
aacagaattttcattcatgcatagtctgaagaaagttccatgctttagcttcctttatgtgcttatgtgcatcttgagaggagaggatatgtgaagtatc |
12922020 |
T |
 |
| Q |
119 |
atcattatatgcagtataactgcacaactaaacagtgaggtaattcattcagaacaatttgactggacaaagatttacgtgcagcaagatcttattcatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12922019 |
atcattatatgcagtataactgcacaactaaacagtgaggtaattcattcagaacaatttgactggacaaagatttacgtgcagcaagatcttattcatt |
12921920 |
T |
 |
| Q |
219 |
taatgcnnnnnnnnnnnnggtattcagtgtatgttatgtcacttcccaaagaggcaaactctgcgcaatgtctctg |
294 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12921919 |
taatgcttttttatttttggtattcagtgtatgttatgtcacttcccaaagaggcaaactctgcgcaatgtctctg |
12921844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University