View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7377_low_15 (Length: 230)
Name: NF7377_low_15
Description: NF7377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7377_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 211
Target Start/End: Complemental strand, 26333927 - 26333730
Alignment:
| Q |
14 |
aatatcataactgggaaacttctgaacttaatactaataataatcataatcataatcatattaaccaagttggtccaattaatggtgcacctaaattcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26333927 |
aatatcataactgggaaacttctgaacttaatactaataataatcataatcataatcataataaccaagttggtccaattaatggtgcacctaaattcaa |
26333828 |
T |
 |
| Q |
114 |
atctgttcaaccaccttcattacctctttcatcttcaccatcttttcacttaccattttcatctacttttagtcctactgatttcttgatctcacctt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26333827 |
atctgttcaaccaccttcattacctctttcatcttcaccatcttttcacttaccattttaatctacttttagtcctactgatttcttgatctcacctt |
26333730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University