View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7377_low_16 (Length: 207)
Name: NF7377_low_16
Description: NF7377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7377_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 50 - 189
Target Start/End: Complemental strand, 14260996 - 14260858
Alignment:
| Q |
50 |
ggttatggttatgaattatgtgtattttgaatgttaggtttattttgtaatgtttaagggtgaattagattgatgtatattcagtttttagctgaatttg |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14260996 |
ggttatggttatgaattatgtgtattttgaatgttag-tttatttcgtaatgtttaatggtgaattagattgatgtatattcagtttttagctgaatttg |
14260898 |
T |
|
| Q |
150 |
aaatttgaattcaatgaaagagtaatgtttgggtaatttt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14260897 |
aaatttgaattcaatgaaagagtaatgtttgggtaatttt |
14260858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 14261033 - 14260984
Alignment:
| Q |
1 |
tcggatgtcgaagaatatgatgaagaagttgatttagggttatggttatg |
50 |
Q |
| |
|
||||| || |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14261033 |
tcggaggttgaagaagatgatgaagaagttgatttagggttatggttatg |
14260984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University