View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7377_low_2 (Length: 461)
Name: NF7377_low_2
Description: NF7377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7377_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 1e-57; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 110 - 230
Target Start/End: Complemental strand, 10148681 - 10148560
Alignment:
| Q |
110 |
attatgatcgtgcaaatcaattcaaattatttatatggtatcaaattctactcattttcatttgaaaggatacataattgctttaat-aaacactttaac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10148681 |
attatgatcgtgcaaatcaattcaaattatttatatggtatcaaattctactcattttcatttgaaaggatacataattgctttaataaaacactttaac |
10148582 |
T |
|
| Q |
209 |
tcatcaagaaaattgatgtaaa |
230 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
10148581 |
tcatcaagaaaattgatgtaaa |
10148560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 245 - 315
Target Start/End: Complemental strand, 10148574 - 10148504
Alignment:
| Q |
245 |
gaaaattgatgtaaatctcctaacttctccaatgaaatttcaattttatccatccattatttatgccaaag |
315 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10148574 |
gaaaattgatgtaaatctcctaacttttccaatgaaatttcaattttatccatccattatttatgccaaag |
10148504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 395 - 449
Target Start/End: Complemental strand, 10148422 - 10148364
Alignment:
| Q |
395 |
aactatatgatgcattgatgcttctttatat----acgtcagtcttttggtgtgagtat |
449 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10148422 |
aactatatcatgcattgatgcttctttatatgtatacgtcagtcttttggtgtgagtat |
10148364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University