View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7378_high_8 (Length: 210)
Name: NF7378_high_8
Description: NF7378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7378_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 44 - 192
Target Start/End: Complemental strand, 2256422 - 2256274
Alignment:
| Q |
44 |
taccgacgttggcagagttgagtttgacggatggggagatattgaggttgagagaattagggtatcagatgaagcagaagattaaggttgggaaagccgg |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2256422 |
taccgacgttggcagagttgagtttgacggatggggagatattgaggttgagagaattagggtatcagatgaagcagaagattaaggttgggaaagccgg |
2256323 |
T |
 |
| Q |
144 |
tgtaacggaagggattgttaatggaattcatgaacggtggcgaagatcg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2256322 |
tgtaacggaagggattgttaatggaattcatgaacggtggcgaagatcg |
2256274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University