View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7378_high_8 (Length: 210)

Name: NF7378_high_8
Description: NF7378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7378_high_8
NF7378_high_8
[»] chr6 (1 HSPs)
chr6 (44-192)||(2256274-2256422)


Alignment Details
Target: chr6 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 44 - 192
Target Start/End: Complemental strand, 2256422 - 2256274
Alignment:
44 taccgacgttggcagagttgagtttgacggatggggagatattgaggttgagagaattagggtatcagatgaagcagaagattaaggttgggaaagccgg 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2256422 taccgacgttggcagagttgagtttgacggatggggagatattgaggttgagagaattagggtatcagatgaagcagaagattaaggttgggaaagccgg 2256323  T
144 tgtaacggaagggattgttaatggaattcatgaacggtggcgaagatcg 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
2256322 tgtaacggaagggattgttaatggaattcatgaacggtggcgaagatcg 2256274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University