View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7378_low_8 (Length: 320)
Name: NF7378_low_8
Description: NF7378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7378_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 190 - 307
Target Start/End: Complemental strand, 53012828 - 53012711
Alignment:
| Q |
190 |
gtaaatatcaaactaagaatttaatttgtttgtgtaaaacaagttttgtgaaaacgttcaattatattatatgtgccacaaatagagatttgaacatgta |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53012828 |
gtaaatatcaaactaagaatttaatttgtttgtgtaaaacaagttttgtgaaaacgttcaattatattatatgtgccacaaatagagatttgaacatgta |
53012729 |
T |
 |
| Q |
290 |
cacttggtagtgatatat |
307 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
53012728 |
cacttggtagtgatatat |
53012711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 19 - 150
Target Start/End: Complemental strand, 53012991 - 53012860
Alignment:
| Q |
19 |
aattttacagtatagcattcactctttatatttgttcataaaacttaactcaaatcgataaatatcgatattgttagtttaaacattttcgtacgaattc |
118 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53012991 |
aattttacagtacaacattcactctttatatttgttcataaaacttaactcaaaccgataaatatcgatattgttagtttaaacattttcgtacgaattc |
53012892 |
T |
 |
| Q |
119 |
caacccgaaaccatgcttttaagaagcaaatg |
150 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |
|
|
| T |
53012891 |
caacctgaaaccatgcttttaagaagcaaatg |
53012860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University