View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7379_low_3 (Length: 270)
Name: NF7379_low_3
Description: NF7379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7379_low_3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 18 - 270
Target Start/End: Complemental strand, 44490209 - 44489957
Alignment:
| Q |
18 |
ctatagtcatgtgttgcacgaattgaactcaaatccaacacaaaccccaaccaaccactacatatataaattttgaaatctagctagctctctttctata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
44490209 |
ctatagtcatgtgttgcacgaattgaactcaaatccaacacaaaccccaaccaaccactacatatataaaatttgaaatctagatagctctctttctata |
44490110 |
T |
 |
| Q |
118 |
ttgcaatattgcatgtcctttataacaatgggttggaaagccttctctattgctactacattctcaattttctttctccttccattctttgcatttctag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44490109 |
ttgcaatattgcatgtcctttataacaatgggttggaaagccttctctattgctactacattctcaattttctttctccttccattctttgcatttctag |
44490010 |
T |
 |
| Q |
218 |
ctaccgcaaatgacactcttgtacctccagaaaccatttgtaaatcatcccaa |
270 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44490009 |
ctaccgcaaatgacacccttgtacctccagaaaccatttgtaaatcatcccaa |
44489957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University