View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7380_high_42 (Length: 244)

Name: NF7380_high_42
Description: NF7380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7380_high_42
NF7380_high_42
[»] chr2 (1 HSPs)
chr2 (45-226)||(14135343-14135525)


Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 45 - 226
Target Start/End: Complemental strand, 14135525 - 14135343
Alignment:
45 aaagtgaatattcatccttcaaaatcccctattattaaggaagtagttcgacatcctgctattgatcattggatcgaatgaaacactgatggtgcaacca 144  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
14135525 aaagtgaatattcatccttcaaaatcccctattattgaggaagtagttcgacatcctgctattgatcattggatcgaatgaaacactgatggtgcatcca 14135426  T
145 taggtaatcctggtctttcttcatgtcagggcatcttcatgaaca-agatgttcatttcttaggctgtttcacggaagggtta 226  Q
    |||||||||||| |||||||||||||| |||||||||||| |||| | ||||||||||||||||||||| |||||||||||||    
14135425 taggtaatcctgatctttcttcatgtcggggcatcttcataaacacaaatgttcatttcttaggctgttccacggaagggtta 14135343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University