View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7380_high_42 (Length: 244)
Name: NF7380_high_42
Description: NF7380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7380_high_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 45 - 226
Target Start/End: Complemental strand, 14135525 - 14135343
Alignment:
| Q |
45 |
aaagtgaatattcatccttcaaaatcccctattattaaggaagtagttcgacatcctgctattgatcattggatcgaatgaaacactgatggtgcaacca |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
14135525 |
aaagtgaatattcatccttcaaaatcccctattattgaggaagtagttcgacatcctgctattgatcattggatcgaatgaaacactgatggtgcatcca |
14135426 |
T |
 |
| Q |
145 |
taggtaatcctggtctttcttcatgtcagggcatcttcatgaaca-agatgttcatttcttaggctgtttcacggaagggtta |
226 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||| |||| | ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14135425 |
taggtaatcctgatctttcttcatgtcggggcatcttcataaacacaaatgttcatttcttaggctgttccacggaagggtta |
14135343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University