View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7380_high_51 (Length: 229)
Name: NF7380_high_51
Description: NF7380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7380_high_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 442687 - 442892
Alignment:
| Q |
11 |
aataatatatatttattattgtagcttcaaagtgttatgtttaagatgctacaggtttgtcaattactgaacttttccatcatttggtacatcctaaggt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
442687 |
aataatatatatttattattgtagcttcagagtgttatgtttaagatgctacaggtttgtcaattactgaacttttccatcatttggtacatcctaaggt |
442786 |
T |
 |
| Q |
111 |
gcatcattggtttagcttaaattttgaataaaattttagagaaggatactgattatgaggaacatcaaacactagctttctgtcaccaatattatttgtt |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
442787 |
gcatcattggtttagcttaaatcttgaataaaattttagagaaggatactgattatgaggaacatcaaacactagctttctgtcaccaatattatttgtt |
442886 |
T |
 |
| Q |
211 |
attatt |
216 |
Q |
| |
|
|||||| |
|
|
| T |
442887 |
attatt |
442892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 35 - 76
Target Start/End: Original strand, 444516 - 444557
Alignment:
| Q |
35 |
cttcaaagtgttatgtttaagatgctacaggtttgtcaatta |
76 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
444516 |
cttcagagtgtcatgtttaagatgctacaggtttgtgaatta |
444557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University