View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7380_high_54 (Length: 225)
Name: NF7380_high_54
Description: NF7380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7380_high_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 9 - 200
Target Start/End: Complemental strand, 10123796 - 10123608
Alignment:
| Q |
9 |
gagtgagaagaataaatcaggtagttcagtgagtttgttagggttatgcctcaaaacaataannnnnnnngctattaaatgattagctaaaaaaaggttt |
108 |
Q |
| |
|
||||||||| || ||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
10123796 |
gagtgagaaaaacaaatcaggtagttcaatgagtttgttagggttatgcctcaaaacaataa-tttttttgctattaaatgattagct-aaaaaaggttt |
10123699 |
T |
 |
| Q |
109 |
gtttgttatgtgtcnnnnnnnnnnnnnnnngtttgttaaaattttgagtggaaagaggaaaagtttgttgtaattaatcagccagaaaaagg |
200 |
Q |
| |
|
||||||||||||| |||||||| ||||||| ||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
10123698 |
gtttgttatgtgt-aaaaaaaaaaaaaatagtttgttacaattttgcgtggaaagaggtaaagtttgttgtaattaatcagcccgaaaaagg |
10123608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University