View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7380_low_28 (Length: 357)
Name: NF7380_low_28
Description: NF7380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7380_low_28 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 13 - 357
Target Start/End: Original strand, 33315090 - 33315436
Alignment:
| Q |
13 |
tggacatccaatcatgtaaagaaacaaaagcccttgttcggcttccacaatattccaactatgtgtatcaacaggtttatgcatttgttttccagtgaaa |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
33315090 |
tggacatacaatcatgtaaagaaacaaaagcccttgttcggcttccacaatattccaactatttgtatcaccaggtttatgcattcgttttccagtgaaa |
33315189 |
T |
 |
| Q |
113 |
tatatgtttgtccctgtgaatcctata--gtgaacttgtgttgcacaacaaatcctcatgatcagttgggcaaattaaaggccaaaggtttttggcttgt |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33315190 |
tatatgtttgtccctgtgaatcctatatagtgaacttgtgttgcacaacaaatcctcatgatcagttgggcaaattaaaggccaaaggtttttggcttgt |
33315289 |
T |
 |
| Q |
211 |
gaccttggacttggttctgaaatcacaatatctcgaatctcatttgaaattactcgggcgatgtctgtctcgttctttgtaatactatactgtcacatgt |
310 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33315290 |
gaccttggacttggttctcaaatcacaatatctcgaatctcatttgaaattactcgggcgatgtctgtctcgttctttgtaataatatactgtcacatgt |
33315389 |
T |
 |
| Q |
311 |
aacatattcaattgtggaagaagtgtggcttttgggcttaatgttcc |
357 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33315390 |
accatattcaattgtggaagaagtgtggcttttgagcttaatgttcc |
33315436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University