View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7380_low_30 (Length: 347)
Name: NF7380_low_30
Description: NF7380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7380_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 328
Target Start/End: Complemental strand, 51770481 - 51770154
Alignment:
| Q |
1 |
gaaggattgttgtgttgtgtggaattgaaatttttggtcactgttttttccc-tttatgctagcagttgttgcaacatgatttgacacactagtgtagtg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51770481 |
gaaggattgttgtgttgtgtggaattgaaatttttggtcactgttttttcccctttatgctagcagttgttgcaacatgatttgacacactagtgtagtg |
51770382 |
T |
|
| Q |
100 |
gggcttattttctgtgaccnnnnnnnnnnnnnnnnnnn---tgtctcattaggattaccataataaacatacatacattgttctttatttagtttatcaa |
196 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51770381 |
gggcttattttctgtgaccttattatattattattattatttgtctcattaggattaccataataaacatacat----tgttctttatttagtttatcaa |
51770286 |
T |
|
| Q |
197 |
cataaatattaagaataaaatattgcatgatctctctctcagaaaaggaaggttcacgggtatccattctttaggtcaaagaaagtaaagagaaaccgtt |
296 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51770285 |
cataaatattaggaataaaatattgcatgatctctctctcagaaaaggaaggttcacgggtatccattctttaggtcaaagaaagtaaagagaaaccgtt |
51770186 |
T |
|
| Q |
297 |
gtttaggatttactactacttactacagtatt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51770185 |
gtttaggatttactactacttactacagtatt |
51770154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University