View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7380_low_37 (Length: 280)
Name: NF7380_low_37
Description: NF7380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7380_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 51; Significance: 3e-20; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 12794749 - 12794811
Alignment:
| Q |
108 |
ttgcttcatagatgatggtatatattctatgttgttgtactatgagtagaatcttgtggcatc |
170 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12794749 |
ttgcttcatagatgattgtattaattctatgttgttgtactatgagtagaatcttgtggcatc |
12794811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 108 - 170
Target Start/End: Original strand, 12731948 - 12732010
Alignment:
| Q |
108 |
ttgcttcatagatgatggtatatattctatgttgttgtactatgagtagaatcttgtggcatc |
170 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12731948 |
ttgcttcatagatgattgtattaattctatgttgttgtactatgagtagaatcttatggcatc |
12732010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 257
Target Start/End: Original strand, 12794847 - 12794922
Alignment:
| Q |
180 |
ttgttactggtttacgctgtttgcgtcttgtgctatctatgatttatgtgatcaagtactgttatgttgtgttgtgtc |
257 |
Q |
| |
|
|||||| ||||||| | | ||||| |||||| |||| |||||||| ||||| ||||||||||| ||||||||||||| |
|
|
| T |
12794847 |
ttgttattggtttatgttatttgcatcttgttctatttatgattt--gtgattaagtactgttaagttgtgttgtgtc |
12794922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University