View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7380_low_42 (Length: 253)

Name: NF7380_low_42
Description: NF7380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7380_low_42
NF7380_low_42
[»] chr5 (2 HSPs)
chr5 (55-245)||(14771652-14771841)
chr5 (13-57)||(14771824-14771868)


Alignment Details
Target: chr5 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 55 - 245
Target Start/End: Complemental strand, 14771841 - 14771652
Alignment:
55 cagaaagaatggatgcagcctgcttttggctaagctacattctcttttaacaataaaggcnnnnnnnnacgccatctattctagagtttagcacaaatcc 154  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||| ||    
14771841 cagaaagaatggatgcagcctgcttttggctaagctacattctcttttaacaataaaggcttttttt-acgccatctattctagagtttagcacaaaccc 14771743  T
155 ccatagcagtatcgtgaaaaattggattggattgctgccgattctcattatagaggaaaaaataattaagaattatgttgtgattgatgat 245  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14771742 ccatagcagtatcgtgaaaaattggattggattgctgccgattctcattatagaggaaaaaataattaagaattatgttgtgattgatgat 14771652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 57
Target Start/End: Complemental strand, 14771868 - 14771824
Alignment:
13 aatctaaacagtgcaaaagcatctacccagaaagaatggatgcag 57  Q
    ||||||||||||||||||| |||||||||||||||||||||||||    
14771868 aatctaaacagtgcaaaagtatctacccagaaagaatggatgcag 14771824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University