View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7381_high_12 (Length: 226)
Name: NF7381_high_12
Description: NF7381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7381_high_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 40 - 226
Target Start/End: Original strand, 52882997 - 52883183
Alignment:
| Q |
40 |
agctgagctgaggaagagtctataaagtaaaaccctctccgtcactgctaactagggtttagagatggatgaagttggtgttatacttgaaggaactctg |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52882997 |
agctgagctgaggaagagtctataaagtaaaaccctctccgtcactgctaactagggtttagagatggatgaagttggtgttatacttgaaggaactctg |
52883096 |
T |
 |
| Q |
140 |
agtccgaatccgaatgaaagaaaggctgctgaacaaaggttggatgagatccaatatgcacccaatcatcttccaactattttacaa |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52883097 |
agtccgaatccgaatgaaagaaaggctgctgaacaaaggttggatgagatccaatatgcacccaatcatcttccaactattttacaa |
52883183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University