View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7381_high_6 (Length: 356)
Name: NF7381_high_6
Description: NF7381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7381_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 4e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 228 - 344
Target Start/End: Complemental strand, 10522922 - 10522806
Alignment:
| Q |
228 |
ccaaattggtgctttaagtattaaaacattatcacaattagaaattgagtgataagttggtttggtggtttaagggaggaacatacagatttgagtgata |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10522922 |
ccaaattggtgctttaagtattaaaacattatcacaattagaaattgagtgataagttggtttggtggtttaagggaggaacatacagatttgagtgata |
10522823 |
T |
|
| Q |
328 |
aagggattattggttca |
344 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
10522822 |
aagggattatcggttca |
10522806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 19 - 146
Target Start/End: Complemental strand, 10523127 - 10523004
Alignment:
| Q |
19 |
ggttcacatgaaaactaagttgtccatatttatttatttgactaaaggactaaaatattcttatatttttctcatgaaccaaattgaatcttgcatttgt |
118 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10523127 |
ggttcacataaaaactaagttgtccatatttattt----gactaaaggactaaactattcttatatttttctcatgaaccaaattgaatcttgcatttgt |
10523032 |
T |
|
| Q |
119 |
ctcaaggaataagatgcccactcttaac |
146 |
Q |
| |
|
||||||||||||||| |||||||||||| |
|
|
| T |
10523031 |
ctcaaggaataagattcccactcttaac |
10523004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University