View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7381_high_9 (Length: 238)
Name: NF7381_high_9
Description: NF7381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7381_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 5 - 225
Target Start/End: Original strand, 52883367 - 52883577
Alignment:
| Q |
5 |
tcattattttacttactctactcactccattctcactcaattgcactctacctgtttgtaataattcccattcccattcccattcccattccttttcagg |
104 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52883367 |
tcattattttacttactctactc----cattctcactcaattgcactctacctgtttgtaataattc------ccattcccattcccattccttttcagg |
52883456 |
T |
 |
| Q |
105 |
gttcaacttggtgagtgcctcaaaactattcttcattccgattatcccgatcactgtcccaatcttcttgattggatcaaacataatttacacgatcaac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52883457 |
gttcaacttggtgagtgcctcaaaactattcttcattccgattatcctgatcactgtcccaatcttcttgattggatcaaacataatttacacgatcaac |
52883556 |
T |
 |
| Q |
205 |
aacatctctactctgccttat |
225 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
52883557 |
aacatctctactctgccttat |
52883577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University