View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7381_low_12 (Length: 275)
Name: NF7381_low_12
Description: NF7381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7381_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 18 - 270
Target Start/End: Original strand, 18467983 - 18468235
Alignment:
| Q |
18 |
acaaacaagaagctaaatgataatttcttgcctattcagaaccatattgaaccattaaaagccgcaacaacgaaccagccacacaaccaaagagaacaat |
117 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18467983 |
acaaacaagaaactaaatgacaatttcttgcctattcagaaccatattgaaccattaaaagccgcaacaacgaaccagccacacaaccaaagagaacaat |
18468082 |
T |
 |
| Q |
118 |
caagtgacaacctgaaactttaagaaatattgttataacaaccaaagcaaacaccaaaaccaccatgagttgagattcacgacggcactttgcctctttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18468083 |
caagtgacaacctgaaactttaagaaatattgttataacaaccaaagcaaacaccaaaaccaccatgagttgagattcacgacggcactttgcctctttc |
18468182 |
T |
 |
| Q |
218 |
tatatttgaaaaccatccaatacaaccttcatcaacgcaatgaaccaccaaac |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18468183 |
tatatttgaaaaccatccaatacaaccttcgtcaacgcaatgaaccaccaaac |
18468235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University